Question Details

(solution) The following base sequence is a complete polynucleotide made in

The following base sequence is a complete polynucleotide made in a bacterial cell AUGGCGAUAGUUAAACCCGGAGGGUGA ANSWER THE FOLLOWING QUESTIONS. Provide the sequence of nucleotide bases found in the inactive DNA strand of the gene, how many codons will be transcribed in the mRNA made from the template DNA Strand. How many amino acids are coded by the mRNA made and what are the specific amino acids? Why isn't the number of amino acids in the polypeptide?


Solution details:

Pay using PayPal (No PayPal account Required) or your credit card . All your purchases are securely protected by .

About this Question






Sep 13, 2020





We have top-notch tutors who can do your essay/homework for you at a reasonable cost and then you can simply use that essay as a template to build your own arguments.

You can also use these solutions:

  • As a reference for in-depth understanding of the subject.
  • As a source of ideas / reasoning for your own research (if properly referenced)
  • For editing and paraphrasing (check your institution's definition of plagiarism and recommended paraphrase).
This we believe is a better way of understanding a problem and makes use of the efficiency of time of the student.


Order New Solution. Quick Turnaround

Click on the button below in order to Order for a New, Original and High-Quality Essay Solutions. New orders are original solutions and precise to your writing instruction requirements. Place a New Order using the button below.


Order Now