(solution) The following base sequence is a complete polynucleotide made in

(solution) The following base sequence is a complete polynucleotide made in

The following base sequence is a complete polynucleotide made in a bacterial cell AUGGCGAUAGUUAAACCCGGAGGGUGA ANSWER THE FOLLOWING QUESTIONS.¬†Provide the sequence of nucleotide bases found in the inactive DNA strand of the gene, how many codons will be transcribed in the mRNA made from the template DNA Strand. How many amino acids are coded by the mRNA made and what are the specific amino acids? Why isn’t the number of amino acids in the polypeptide?